
Mostrar el registro sencillo del ítem
| dc.contributor.author | Shcharbin, Dzmitry | |
| dc.contributor.author | Pedziwiatr, Elzbieta | |
| dc.contributor.author | Chonco, Louis | |
| dc.contributor.author | Bermejo Martín, Jesús Francisco | |
| dc.contributor.author | Ortega, Paula | |
| dc.contributor.author | de la Mata, F Javier | |
| dc.contributor.author | Eritja, Ramon | |
| dc.contributor.author | Gómez, Rafael | |
| dc.contributor.author | Klajnert, Barbara | |
| dc.contributor.author | Bryszewska, Maria | |
| dc.contributor.author | Muñoz-Fernandez, Ma Angeles | |
| dc.date.accessioned | 2024-12-12T10:01:41Z | |
| dc.date.available | 2024-12-12T10:01:41Z | |
| dc.date.issued | 2007-07 | |
| dc.identifier.citation | Shcharbin, D., Pedziwiatr, E., Chonco, L., Bermejo-Martín, J. F., Ortega, P., de la Mata, F. J., ... & Muñoz-Fernandez, M. A. (2007). Analysis of interaction between dendriplexes and bovine serum albumin. Biomacromolecules, 8(7), 2059-2062. | es_ES |
| dc.identifier.issn | 1525-7797 | |
| dc.identifier.uri | http://hdl.handle.net/10366/161089 | |
| dc.description.abstract | [EN] Dendrimers are new nanotechnological carriers for gene delivery. Short oligodeoxynucleotides (ODNs) are a new class of antisense therapy drugs for cancer and infectious or metabolic diseases. The interactions between short oligodeoxynucleotides (GEM91, CTCTCGCACCCATCTCTCTCCTTCT; SREV, TCGTCGCTGTCTCCGCTTCTTCCTGCCA; unlabeled or fluorescein-labeled), novel water-soluble carbosilane dendrimers, and bovine serum albumin were studied by fluorescence and gel electrophoresis. The molar ratios of the dendrimer/ODN dendriplexes ranged from 4 to 7. The efficiency of formation and stability of the dendriplexes depended on electrostatic interactions between the dendrimer and the ODNs. Dendriplex formation significantly decreased the interactions between ODNs and albumin. Thus, the formation of dendriplexes between carbosilane dendrimers and ODNs may improve ODN delivery. | es_ES |
| dc.language.iso | eng | es_ES |
| dc.rights | Attribution-NonCommercial-NoDerivatives 4.0 Internacional | * |
| dc.rights.uri | http://creativecommons.org/licenses/by-nc-nd/4.0/ | * |
| dc.subject | Base Sequence | es_ES |
| dc.subject | DNA Primers | es_ES |
| dc.subject | Dendrimers | es_ES |
| dc.subject | Serum Albumin, Bovine | es_ES |
| dc.subject | Spectrometry, Fluorescence | es_ES |
| dc.subject.mesh | Dendrimers | * |
| dc.subject.mesh | Base Sequence | * |
| dc.subject.mesh | DNA Primers | * |
| dc.subject.mesh | Serum Albumin | * |
| dc.title | Analysis of interaction between dendriplexes and bovine serum albumin. | es_ES |
| dc.type | info:eu-repo/semantics/article | es_ES |
| dc.relation.publishversion | https://doi.org/10.1021/BM070333P | es_ES |
| dc.identifier.doi | 10.1021/bm070333p | |
| dc.relation.projectID | CTQ2005-00795/BQU | es_ES |
| dc.relation.projectID | SAF-2004-06778 | es_ES |
| dc.relation.projectID | SAF-2003-09209 | es_ES |
| dc.relation.projectID | RIS G03/173 | es_ES |
| dc.relation.projectID | PI061479 | es_ES |
| dc.relation.projectID | FIPSE (Grant 36514/05) | es_ES |
| dc.relation.projectID | Grant BQU2004-02048 | es_ES |
| dc.relation.projectID | BM04-52-0 | es_ES |
| dc.relation.projectID | CM04/00136 | es_ES |
| dc.relation.projectID | Marie Curie International Incoming Fellowship (Grant 510018) | es_ES |
| dc.relation.projectID | Kasa Mianowski Fund | es_ES |
| dc.rights.accessRights | info:eu-repo/semantics/embargoedAccess | es_ES |
| dc.identifier.pmid | 17583948 | |
| dc.journal.title | Biomacromolecules | es_ES |
| dc.volume.number | 8 | es_ES |
| dc.issue.number | 7 | es_ES |
| dc.page.initial | 2059 | es_ES |
| dc.type.hasVersion | info:eu-repo/semantics/publishedVersion | es_ES |
| dc.subject.decs | secuencia de bases | * |
| dc.subject.decs | albúmina sérica | * |
| dc.subject.decs | dendrímeros | * |
| dc.subject.decs | cebadores de ADN | * |








