2026-09-15T08:40:56Zhttps://gredos.usal.es/oai/request

oai:gredos.usal.es:10366/1610892025-04-30T19:35:54Zcom_10366_4019com_10366_3947com_10366_3946com_10366_3823col_10366_4020

Shcharbin, Dzmitry Pedziwiatr, Elzbieta Chonco, Louis Bermejo Martín, Jesús Francisco Ortega, Paula de la Mata, F Javier Eritja, Ramon Gómez, Rafael Klajnert, Barbara Bryszewska, Maria Muñoz-Fernandez, Ma Angeles 2024-12-12T10:01:41Z 2024-12-12T10:01:41Z 2007-07 Shcharbin, D., Pedziwiatr, E., Chonco, L., Bermejo-Martín, J. F., Ortega, P., de la Mata, F. J., ... & Muñoz-Fernandez, M. A. (2007). Analysis of interaction between dendriplexes and bovine serum albumin. Biomacromolecules, 8(7), 2059-2062. 1525-7797 http://hdl.handle.net/10366/161089 10.1021/bm070333p 17583948 [EN] Dendrimers are new nanotechnological carriers for gene delivery. Short oligodeoxynucleotides (ODNs) are a new class of antisense therapy drugs for cancer and infectious or metabolic diseases. The interactions between short oligodeoxynucleotides (GEM91, CTCTCGCACCCATCTCTCTCCTTCT; SREV, TCGTCGCTGTCTCCGCTTCTTCCTGCCA; unlabeled or fluorescein-labeled), novel water-soluble carbosilane dendrimers, and bovine serum albumin were studied by fluorescence and gel electrophoresis. The molar ratios of the dendrimer/ODN dendriplexes ranged from 4 to 7. The efficiency of formation and stability of the dendriplexes depended on electrostatic interactions between the dendrimer and the ODNs. Dendriplex formation significantly decreased the interactions between ODNs and albumin. Thus, the formation of dendriplexes between carbosilane dendrimers and ODNs may improve ODN delivery. eng http://creativecommons.org/licenses/by-nc-nd/4.0/ info:eu-repo/semantics/embargoedAccess Attribution-NonCommercial-NoDerivatives 4.0 Internacional Base Sequence DNA Primers Dendrimers Serum Albumin, Bovine Spectrometry, Fluorescence Analysis of interaction between dendriplexes and bovine serum albumin. info:eu-repo/semantics/article